|
Post by jarvitronics on Oct 5, 2007 19:12:30 GMT -5
There are different perspectives on the mathematical relevance of the cover, but I am convinced that it is significant and a little sinister. Incidentally, the picture beside it is seen as 63/64. For an explanation, see www.amun.com/eng/horus_e.htmlThe combination of these fractions is suggestive of the binary numbers used by computers. 63/64 is the fraction made when the first six binary bits after the decimal point are all set to one: 0.111111 (The first bit after the decimal is worth 1/2, the second is worth 1/4, the third 1/8, then 1/16, 1/32, and 1/64.) The number 64 itself is two raised to the sixth power. Going the other way, the sixth root of two is the mathematical interval of a musical whole step, such as from A to B, or from C to D. -j
|
|
|
Post by iameye on Oct 5, 2007 19:23:46 GMT -5
related?
"There are four letters in the DNA alphabet: A, C, G, and T, which stand for adenine, cytosine, guanine, and thymine. These are the names of special molecules called nitrogenous bases, which are often just called bases.
Each word is made up of some combination of three letters, for a total of 64 possible words. The instructions for every protein in every cell of the body are made up of combinations of these 64 words."
|
|
|
Post by The Deceptionist on Oct 5, 2007 19:39:10 GMT -5
|
|
jilly
Hard Day's Night
Posts: 12
|
Post by jilly on Oct 5, 2007 20:12:33 GMT -5
can someone tell me which web page those eyes are on? please
|
|
|
Post by iameye on Oct 5, 2007 20:18:16 GMT -5
|
|
|
Post by jarvitronics on Oct 5, 2007 21:19:55 GMT -5
related? "There are four letters in the DNA alphabet: A, C, G, and T, which stand for adenine, cytosine, guanine, and thymine. These are the names of special molecules called nitrogenous bases, which are often just called bases. Each word is made up of some combination of three letters, for a total of 64 possible words. The instructions for every protein in every cell of the body are made up of combinations of these 64 words."Aren't DNA words made from just two letters each? T pairs with A, and G with C, and that is all there is. Are you saying it takes a collection of three of these pairings to make a "word?" -j
|
|
|
Post by Mellow Yellow on Oct 5, 2007 21:22:20 GMT -5
I tried to mess with it in paint...... but sumfink went horribly HORRIBLY wrong......
|
|
|
Post by iameye on Oct 5, 2007 22:42:57 GMT -5
\ no. I'll let a professional explain: "Many of you have watched enough television, or at least remember enough of our high school biology, to know that the substance with the information to form life is -- deoxyribonucleic acid, or DNA . DNA is the source of the three letter words that determine what the life form will be and how it functions. The genetic code words are made from just four letters, A, C, G, and T, which correspond to the four nitrogenous bases (that's , adenine, cytosine, guanine, and thymine. Because there are three letters in each code word and only four letters to choose from, the genetic code has just 64 (43) words. Sixty-four words to spell out the information necessary to make all the forms of life on our planet! Now 64 as you know is twice the inner path of the 8 and therefore the tree of good and bad. (RB) How does this code work ? A closer look at the genetic code reveals several levels of information that reveals a structural source. How the genetic code is translated into functional proteins that make life possible is similar to how an designer produces a design of a car and then has someone deliver it to a factory who builds the car. In a cell, DNA would be the design; a similar nucleic acid, messenger RNA (mRNA) would be the messenger; and the cellular machinery for protein synthesis would be the factory and his workers. In DNA, the four bases, A, C, G, and T, are arranged in a long chain or polymer to provide the design for building a specific car model, or make that protein. These letters are arranged in a chain with two strands forming a double-stranded molecule. One strand has the coding information and the complementary strand is used as a template to correct damage (mutations) to the coding strand.
DNA Coding Sequence GAGTAGCAGTCCCCACCTTGACGC DNA Complementary Sequence CTCATCGTCAGGGGTGGAACTGCG Notice that G pairs with C, and A pairs with T in the double-stranded DNA molecule. This complementary base pairing facilitates the transcription of a message from DNA to the cellular machinery through mRNA. To write a message to the protein synthesis machinery (the designer) in the cell, the two DNA strands separate, and enzymes (proteins) construct a complementary mRNA strand, which differs from DNA by having a different base, U (uracil), in place of T (thymine). " DNA Coding Sequence GAG-TAG-CAG-TCC-CCA-CCT-TGA-CGC mRNA CUC-AUC-GUC-AGG-GGU-GGA-ACU-GCG The sequences are segmented in this example to show the three letter "words" in the mRNA called codons that are responsible for taking the genetic code to the protein synthesis machinery in the cell. A protein is made from amino acids linked together in a chain. These chains can then be folded into filaments or globules depending on the particular function of the protein. If this were an actual protein, the first four amino acids would be leucine, isoleucine, valine, and arginine based on the four code words or codons, CUC, AUC, GUC, and AGG. There are just 20 amino acids typically found in living things and 64 codons. Because of this, each amino acid has more than one codon. Leucine and arginine have six codons while most of the other amino acids have two or four codons. For this reason the code has frequently been referred to as "redundant" and the third letter of each codon was once thought to be "junk" since this letter in many of the codons does not affect the amino acid chosen by the cellular machinery. Does this mean the genetic code is redundant or is there additional information in these codons? Codons that are similar to each other correspond to amino acids with similar chemical properties. In fact, the most used codons are those that, when mutated, keep on coding for the same amino acid or an amino acid that has similar chemical properties . Leucine, with six different codons, CUC, CUA, CUU, CUG, UUA, and UUG, provides a good example of how base substitutions might not affect the amino acid sequence in a protein. A mutation in the DNA sequence resulting in an mRNA change in the third letter for four of the leucine codons starting with cytosine (C) would not change the amino acid sequence. For example, from the sequence above CUC-AUC-GUC-AGG, a mutation that changes the codon CUC to CUA would still place leucine at the beginning of the amino acid sequence. This type of mutation is referred to as a synonymous or neutral mutation causing no change in the protein sequence. A more interesting scenario would be if the first base in the second codon were changed from AUC to CUC. Leucine would substitute for isoleucine at the second position in this sequence. However, isoleucine, leucine, and valine all have very similar chemical properties and substituting these amino acids for each other might result in very minor changes in the structure and function of the affected protein. By contrast, arginine, an amino acid with quite different chemical properties from the other three in the example, also has a set of codons that are quite different. In most cases, it would take multiple mutations to change an arginine codon to a codon for one of the other three amino acids. The genetic code is arranged to minimize the affects of mistakes (mutations) in the synthesized protein and to reduce the occurrence of random changes in the organism. The code also has information that determines the amount and rate of protein production. To assemble a protein, mRNA codons are "read" by another nucleic acid, transfer RNA (tRNA), which in turn correctly aligns specific amino acids in the newly forming protein. For the codon CUC, tRNA attaches leucine to the amino acid sequence. Each tRNA bonds to mRNA with a complementary anti-codon (GAG in this case). If the protein being synthesized has several leucine amino acids, synthesis will go faster if the mRNA codons are CUC and there is a large population of tRNA with a GAG anti-codon. The rate of protein synthesis will be much slower if there are many CUC codons for leucine and few tRNAs with a GAG anti-codon. This preference is called codon usage bias. Proteins that are produced in large quantities by the cell have mRNA codons that match the most common tRNA anti-codons available . Proteins that are in low concentration in the cell do not utilize the codon bias towards the most common tRNA species available and consequently, are synthesized at slower rates . The codon usage bias helps to regulate the amount of a particular protein produced in the cell. Synonymous mutations in DNA that change an mRNA codon, but do not change the amino acid sequence, potentially can cause changes in the amount of a specific protein in a cell by altering the speed that these proteins are produced, consequently altering cellular functions. Although the third base in many codons may not be important in determining the amino acid sequence, this position has information that affects the structure of mRNA . Remember, the third letter in the leucine codons CUA, CUU, CUC, CUG, are synonymous sites, but each of these codons might produce different secondary structures. The mRNA secondary structure helps determine how long mRNA will last in the cell before being metabolized or degraded. The amount of protein a cell can make from mRNA is directly related to how long the mRNA persists in the cell. Synonymous mutations have been shown to affect the secondary structure and the decay rate of mRNA , which in turn affects how much of a specific protein is produced in the cell. Although the protein sequence is unaffected, altering the amount of a protein in the cell by changing mRNA secondary structure through "synonymous" mutations (CUA, CUU, e.g.) is associated with diseases in humans. These disorders emphasize the importance of maintaining the sequence integrity of the "redundant" third letter in the codon, and how changing it affects normal cellular functions. The current data indicate that all of the bases in the genetic code are important for producing the correct protein in the appropriate amounts in the cell, and these are just a few of the examples of the information contained in the DNA code. It may be that when all of the information is deciphered from the genetic code, terms such a "synonymous," "neutral," and "redundant," will be obsolete, in written form, is evidence of intelligence, the words of the genetic code are evidence of an Intelligent Author, and this Author of Life has loaded the genetic code with much information using little three-letter words! ' by Daniel Criswell, Ph.D.
|
|
|
Post by jarvitronics on Oct 5, 2007 22:55:37 GMT -5
Fascinating article iameye. Thanks.
-j
|
|
|
Post by iameye on Oct 5, 2007 23:13:32 GMT -5
think of it this way................ O O O O < < < < /\ / /\ / /\ / /\ / edit: well I tried, can't do it. you know what I mesn
|
|
|
Post by iameye on Oct 5, 2007 23:53:51 GMT -5
or this: fi rst four amino acids would be leucine, isoleucine, valine, and arginine based on the four code words or codons, CUC, AUC, GUC, and AGG.GUC AUC AGG CUC Goob-goob-a-joob
|
|
|
Post by plastic paul on Oct 6, 2007 2:53:01 GMT -5
I think if Ilras had done this from the start: Then there would be no complaints? Imo, the first post was not an example of manipulation, it was just illustration. I agree JoJo, there was a lot of needless arguments there, but to me I see the example of "666" but I don't buy into it. IMO it's one of those things that is symbolic to a lot of people, yet I feel that it's only symbolic if you buy into the whole "devil's number" crap. It's one of those things that you see if you want to. If i'm honest, I saw "69" before I saw "666" ;D
|
|
|
Post by MikeNL on Oct 6, 2007 4:38:29 GMT -5
This image clearly shows Bert is involved in some serious devil worshipping Point; if this is McCartney's eye.. you can simply overlay it.. and see it fit's, there conclusion is that it is something from nature, and therefore NOT some devil 666 shit and even though you can see a 6 in the cover still doesn't mean 666... just my 2 eurocent, Mike
|
|
|
Post by il ras on Oct 6, 2007 4:44:22 GMT -5
You could simply write this, if you like this kind of humor, instead of involving manipulation when there wasn't any....
|
|
|
Post by il ras on Oct 6, 2007 4:48:45 GMT -5
Plus, as you wrote i agree only when this happens when you keep the image in it's whole.. but now you've got the eye cut out.. and that's manipulation.. and not really valid or somthing now that has been clarified that there wasn't any manipulation, you should coherently agree....
|
|
|
Post by MikeNL on Oct 6, 2007 4:55:47 GMT -5
It's an EYE.. and an eye is made by nature.. and not by humans, so you can't say it has something to do with 666
|
|
|
Post by jarvitronics on Oct 6, 2007 7:18:15 GMT -5
It's an EYE.. and an eye is made by nature.. and not by humans, so you can't say it has something to do with 666 Why not? That eye was made by humans. And why does 666 have to mean evil? Before Revelation 13 came along, 666 was a highly revered number that meant GOOD things. -j
|
|
|
Post by MikeNL on Oct 6, 2007 7:43:10 GMT -5
the eye from the cover is a replica of McCartney's eye..
|
|
|
Post by The Deceptionist on Oct 6, 2007 7:43:29 GMT -5
It's an EYE.. and an eye is made by nature.. and not by humans, so you can't say it has something to do with 666 Well - that eye doesn't look particularly natural to me. This is a design, and not a photo remember - some elements of the image will have been exaggerated or altered to fit the design spec, whatever that may be. the eye from the cover is a replica of McCartney's eye.. It wont be a particularly exact replica of his eye IMO.
|
|
|
Post by B on Oct 6, 2007 8:00:29 GMT -5
I tried to mess with it in paint...... but sumfink went horribly HORRIBLY wrong...... Well at least we can see Michael Jackson in the center now. But as for this:Seth-ame Street is full of perversion! What is the real meaning of "Big Bird"? What about "Bert & Ernie"? Beasts living in garbage cans!! You're right, Mike. It's pure evil. And Blue Meanies each side of the pic, and that red devil in the front showing his pee pee! Tsk, tsk. -jerry faul-well
|
|
|
Post by iameye on Oct 6, 2007 8:18:39 GMT -5
I have to agree about the SS children's workshop......just yesterday I paused on a sesame street commercial ( for a live show) and the freeze frame was extremely sexually suggestive, had the sun/eye/target thing and they were all raising hands in the air. Very provoking and this was just a random millisecond.........
|
|
|
Post by MikeNL on Oct 6, 2007 8:48:40 GMT -5
after all, mike was right.. sure lost his head
|
|
|
Post by iameye on Oct 6, 2007 9:18:44 GMT -5
Why do we think it's vogue around here to be cryptic? who started this? maybe the cryptologists should start their own thread together. I would love that
|
|
|
Post by B on Oct 6, 2007 13:01:02 GMT -5
Quoth the raven, "Nevermore!" (Just "be-in" Poetic. Feel free bird to start kickin'.)
|
|
Jude
Hard Day's Night
Acting Naturally
Posts: 34
|
Post by Jude on Oct 6, 2007 14:29:15 GMT -5
And why does 666 have to mean evil? Before Revelation 13 came along, 666 was a highly revered number that meant GOOD things. Sources, please.
|
|